Cherry SNP DataBase

SNP information

Name Pav_sc0000506.1_278148Y
Chr PAV_r1.0chr4
Pos (Chr) 4036163
PAV_r1.0 Pav_sc0000506.1
Pos (PAV_r1.0) 278148
REF C
ALT T
SSR motif
Gene Name Pav_sc0000506.1_g450.1.mk
Annotation PREDICTED: cellulose synthase A catalytic subunit 8
snpEff Effect synonymous_variant
Impact LOW
Codon c.1374C>T
Amino Acid p.Val458Val
PCR Forward primer ACAAAGGTTTCAGGCACTCG
Reverse primer CCAAATTGGATTCCCATATTCA
Product size 349
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/ALT REF/REF REF/REF REF/REF REF/REF REF/REF REF/REF


| Top |