Cherry SNP DataBase

SNP information

Name Pav_sc0000506.1_302934R
Chr PAV_r1.0chr4
Pos (Chr) 4011377
PAV_r1.0 Pav_sc0000506.1
Pos (PAV_r1.0) 302934
REF G
ALT A
SSR motif
Gene Name Pav_sc0000506.1_g500.1.mk
Annotation PREDICTED: probable LRR receptor-like serine/threonine-protein kinase At5g45780
snpEff Effect intron_variant
Impact MODIFIER
Codon c.2292+319C>T
Amino Acid
PCR Forward primer TTTTGCCCGGTTATGAGTTC
Reverse primer AACCATCATTGGATTGGAACA
Product size 325
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/ALT REF/REF REF/REF REF/REF REF/REF REF/REF REF/REF


| Top |