Cherry SNP DataBase

SNP information

Name Pav_sc0000525.1_161981W
Chr PAV_r1.0chr1
Pos (Chr) 14076690
PAV_r1.0 Pav_sc0000525.1
Pos (PAV_r1.0) 161981
REF A
ALT T
SSR motif
Gene Name Pav_sc0000525.1_g410.1.mk
Annotation PREDICTED: small G protein signaling modulator 1 isoform X1
snpEff Effect intron_variant
Impact MODIFIER
Codon c.513-151A>T
Amino Acid
PCR Forward primer CAGGTGTCATCTGGTCATGG
Reverse primer GAATGCATCATTTGGCACTG
Product size 330
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/ALT REF/REF REF/REF REF/REF REF/REF REF/REF


| Top |