Cherry SNP DataBase

SNP information

Name Pav_sc0000543.1_176693S
Chr PAV_r1.0chr4
Pos (Chr) 24688889
PAV_r1.0 Pav_sc0000543.1
Pos (PAV_r1.0) 176693
REF G
ALT C
SSR motif
Gene Name Pav_sc0000543.1_g440.1.mk
Annotation PREDICTED: protein SMG7
snpEff Effect missense_variant
Impact MODERATE
Codon c.980G>C
Amino Acid p.Gly327Ala
PCR Forward primer CGGAAGCAATACCTGCATCT
Reverse primer GCAACTCCTCTGCTCCAGAA
Product size 345
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/REF REF/REF REF/REF REF/ALT REF/REF REF/REF


| Top |