Cherry SNP DataBase

SNP information

Name Pav_sc0000549.1_673013Y
Chr PAV_r1.0chr5
Pos (Chr) 6185630
PAV_r1.0 Pav_sc0000549.1
Pos (PAV_r1.0) 673013
REF C
ALT T
SSR motif
Gene Name Pav_sc0000549.1_g1220.1.mk
Annotation PREDICTED: cullin-1-like
snpEff Effect missense_variant
Impact MODERATE
Codon c.713G>A
Amino Acid p.Ser238Asn
PCR Forward primer AGAACGGTGACGGTCAAATC
Reverse primer GAGCGATGAGGCCATAGAAG
Product size 315
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
ALT/ALT REF/ALT REF/ALT REF/ALT REF/ALT ALT/ALT REF/ALT


| Top |