Cherry SNP DataBase

SNP information

Name Pav_sc0000554.1_1015839W
Chr PAV_r1.0chr2
Pos (Chr) 19584542
PAV_r1.0 Pav_sc0000554.1
Pos (PAV_r1.0) 1015839
REF A
ALT T
SSR motif
Gene Name Pav_sc0000554.1_g2040.1.mk
Annotation PREDICTED: dirigent protein 25-like
snpEff Effect intron_variant
Impact MODIFIER
Codon c.-2550+51A>T
Amino Acid
PCR Forward primer GCAGCAGGACTGCAGAGTAA
Reverse primer TGTACCTGGTGCAGATTCCA
Product size 238
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/ALT REF/REF REF/ALT REF/REF ALT/ALT REF/REF


| Top |