Cherry SNP DataBase

SNP information

Name Pav_sc0000554.1_1031431K
Chr PAV_r1.0chr2
Pos (Chr) 19568950
PAV_r1.0 Pav_sc0000554.1
Pos (PAV_r1.0) 1031431
REF G
ALT T
SSR motif
Gene Name Pav_sc0000554.1_g2070.1.mk
Annotation PREDICTED: splicing factor 3B subunit 3-like
snpEff Effect 3_prime_UTR_variant
Impact MODIFIER
Codon c.*342G>T
Amino Acid
PCR Forward primer CCTCCCCTTTTCCTTCTCAG
Reverse primer GGCAACAAGTAGAGGGATTCA
Product size 338
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/ALT REF/REF REF/ALT REF/REF ALT/ALT REF/REF


| Top |