Cherry SNP DataBase

SNP information

Name Pav_sc0000554.1_294724R
Chr PAV_r1.0chr2
Pos (Chr) 20305657
PAV_r1.0 Pav_sc0000554.1
Pos (PAV_r1.0) 294724
REF A
ALT G
SSR motif
Gene Name
Annotation
snpEff Effect intergenic_region
Impact MODIFIER
Codon n.294724A>G
Amino Acid
PCR Forward primer AGCAATAATGGGCCATGTTC
Reverse primer TGGTTGAAAATGAGAGTGAATCC
Product size 239
Enzymes for CAPS MboI
Exp. fragment size (REF) 136,103
Exp. fragment size (ALT) 239
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
ALT/ALT REF/ALT REF/ALT ALT/ALT REF/ALT ALT/ALT REF/ALT


| Top |