Cherry SNP DataBase

SNP information

Name Pav_sc0000554.1_519556M
Chr PAV_r1.0chr2
Pos (Chr) 20080825
PAV_r1.0 Pav_sc0000554.1
Pos (PAV_r1.0) 519556
REF C
ALT A
SSR motif
Gene Name Pav_sc0000554.1_g1010.1.mk
Annotation PREDICTED: dolichyl-phosphate beta-glucosyltransferase
snpEff Effect splice_region_variant&intron_variant
Impact LOW
Codon c.657+6C>A
Amino Acid
PCR Forward primer GCCCTGGCTACAGTTGAGTC
Reverse primer TGCATGAAGAATACCACGTCA
Product size 348
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/ALT REF/REF REF/REF REF/REF REF/ALT REF/REF


| Top |