Cherry SNP DataBase

SNP information

Name Pav_sc0000554.1_663924S
Chr PAV_r1.0chr2
Pos (Chr) 19936457
PAV_r1.0 Pav_sc0000554.1
Pos (PAV_r1.0) 663924
REF G
ALT C
SSR motif
Gene Name Pav_sc0000554.1_g1320.1.mk
Annotation Ubiquitin-conjugating enzyme E2 13 family protein
snpEff Effect intron_variant
Impact MODIFIER
Codon c.159-73G>C
Amino Acid
PCR Forward primer CGAGCTTTGTGTTTCTGTGC
Reverse primer GGTTGTTCGGGTAATCCTCA
Product size 327
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/ALT REF/REF REF/REF REF/REF REF/ALT REF/REF


| Top |