Cherry SNP DataBase

SNP information

Name Pav_sc0000554.1_954942R
Chr PAV_r1.0chr2
Pos (Chr) 19645439
PAV_r1.0 Pav_sc0000554.1
Pos (PAV_r1.0) 954942
REF A
ALT G
SSR motif
Gene Name Pav_sc0000554.1_g1950.1.br
Annotation PREDICTED: eukaryotic translation initiation factor 5B-like
snpEff Effect intron_variant
Impact MODIFIER
Codon c.175+518A>G
Amino Acid
PCR Forward primer CAAGTTATTTTGGTGCGTGC
Reverse primer ACCAGCAGGAATAGGAGGGT
Product size 286
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/ALT REF/REF REF/ALT REF/REF REF/ALT REF/REF


| Top |