Cherry SNP DataBase

SNP information

Name Pav_sc0000563.1_127426S
Chr PAV_r1.0chr6
Pos (Chr) 4603693
PAV_r1.0 Pav_sc0000563.1
Pos (PAV_r1.0) 127426
REF G
ALT C
SSR motif
Gene Name Pav_sc0000563.1_g220.1.mk
Annotation hypothetical protein VITISV_022309
snpEff Effect intron_variant
Impact MODIFIER
Codon c.1601-46G>C
Amino Acid
PCR Forward primer AATTTGAGGCGACGAATCAT
Reverse primer AGCAATGGCTGCAAAAATCT
Product size 258
Enzymes for CAPS MspI
Exp. fragment size (REF) 143,115
Exp. fragment size (ALT) 258
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
ALT/ALT REF/ALT REF/ALT REF/ALT ALT/ALT REF/ALT REF/ALT


| Top |