Cherry SNP DataBase

SNP information

Name Pav_sc0000578.1_99754K
Chr PAV_r1.0chr7
Pos (Chr) 8674002
PAV_r1.0 Pav_sc0000578.1
Pos (PAV_r1.0) 99754
REF T
ALT G
SSR motif
Gene Name Pav_sc0000578.1_g320.1.mk
Annotation
snpEff Effect missense_variant
Impact MODERATE
Codon c.292T>G
Amino Acid p.Phe98Val
PCR Forward primer TGGGAGAGACATTTGGAAGG
Reverse primer GCCAAAAATAAACACCCCCT
Product size 343
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/REF REF/ALT REF/ALT REF/REF REF/ALT REF/REF


| Top |