Cherry SNP DataBase

SNP information

Name Pav_sc0000582.1_111679R
Chr PAV_r1.0chr8
Pos (Chr) 541614
PAV_r1.0 Pav_sc0000582.1
Pos (PAV_r1.0) 111679
REF A
ALT G
SSR motif
Gene Name Pav_sc0000582.1_g130.1.mk
Annotation PREDICTED: LOW QUALITY PROTEIN: putative ABC transporter C family member 15
snpEff Effect synonymous_variant
Impact LOW
Codon c.2808A>G
Amino Acid p.Leu936Leu
PCR Forward primer GGCCCGACTTTTAACAAACA
Reverse primer TCTTCCAGAGGCTTACCTGC
Product size 345
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/REF REF/REF REF/REF REF/REF REF/ALT REF/REF


| Top |