Cherry SNP DataBase

SNP information

Name Pav_sc0000583.1_321330W
Chr PAV_r1.0chr8
Pos (Chr) 18197958
PAV_r1.0 Pav_sc0000583.1
Pos (PAV_r1.0) 321330
REF T
ALT A
SSR motif
Gene Name Pav_sc0000583.1_g640.1.mk
Annotation PREDICTED: UPF0420 protein C16orf58 homolog
snpEff Effect intron_variant
Impact MODIFIER
Codon c.139-37T>A
Amino Acid
PCR Forward primer GAAAATCAGGACGCTTTTGG
Reverse primer TGACAAACGAGTCAGCCATC
Product size 280
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/ALT ALT/ALT REF/ALT REF/ALT ALT/ALT REF/ALT REF/ALT


| Top |