Cherry SNP DataBase

SNP information

Name Pav_sc0000584.1_177581Y
Chr PAV_r1.0chr4
Pos (Chr) 12137971
PAV_r1.0 Pav_sc0000584.1
Pos (PAV_r1.0) 177581
REF C
ALT T
SSR motif
Gene Name
Annotation
snpEff Effect intergenic_region
Impact MODIFIER
Codon n.177581C>T
Amino Acid
PCR Forward primer TGTTGTCAACTGCATGGGAT
Reverse primer TCTCCAAAGTCTTGCACACG
Product size 258
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/ALT REF/REF REF/REF REF/ALT REF/REF REF/REF REF/REF


| Top |