Cherry SNP DataBase

SNP information

Name Pav_sc0000586.1_263599S
Chr PAV_r1.0chr2
Pos (Chr) 17056494
PAV_r1.0 Pav_sc0000586.1
Pos (PAV_r1.0) 263599
REF C
ALT G
SSR motif
Gene Name
Annotation
snpEff Effect intergenic_region
Impact MODIFIER
Codon n.263599C>G
Amino Acid
PCR Forward primer ACTATTGTGAACCCCCTCCC
Reverse primer GTGGTTGCACTGACAAGGAA
Product size 257
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
ALT/ALT REF/ALT REF/ALT REF/ALT ALT/ALT REF/ALT REF/ALT


| Top |