Cherry SNP DataBase

SNP information

Name Pav_sc0000586.1_506639W
Chr PAV_r1.0chr2
Pos (Chr) 17299534
PAV_r1.0 Pav_sc0000586.1
Pos (PAV_r1.0) 506639
REF T
ALT A
SSR motif
Gene Name Pav_sc0000586.1_g940.1.mk
Annotation PREDICTED: CBL-interacting serine/threonine-protein kinase 9-like
snpEff Effect intron_variant
Impact MODIFIER
Codon c.829-49T>A
Amino Acid
PCR Forward primer TTGCTAGCCAGGCAGAAACT
Reverse primer GGGCGTTGAGAAGTAAAACG
Product size 240
Enzymes for CAPS AluI
Exp. fragment size (REF) 240
Exp. fragment size (ALT) 152,88
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/ALT REF/REF REF/REF REF/ALT REF/REF REF/REF


| Top |