Cherry SNP DataBase

SNP information

Name Pav_sc0000589.1_128237M
Chr PAV_r1.0chr5
Pos (Chr) 10867363
PAV_r1.0 Pav_sc0000589.1
Pos (PAV_r1.0) 128237
REF C
ALT A
SSR motif
Gene Name Pav_sc0000589.1_g270.1.mk
Annotation PREDICTED: uncharacterized protein DDB_G0274915-like isoform X2
snpEff Effect synonymous_variant
Impact LOW
Codon c.2748G>T
Amino Acid p.Thr916Thr
PCR Forward primer GGCATGCTTGAAATCCCATA
Reverse primer GGAGGTCTTTGGGCAACTTT
Product size 300
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/ALT REF/ALT ALT/ALT ALT/ALT ALT/ALT REF/ALT REF/ALT


| Top |