Cherry SNP DataBase

SNP information

Name Pav_sc0000598.1_156127Y
Chr PAV_r1.0chr4
Pos (Chr) 2041265
PAV_r1.0 Pav_sc0000598.1
Pos (PAV_r1.0) 156127
REF C
ALT T
SSR motif
Gene Name Pav_sc0000598.1_g330.1.mk
Annotation PREDICTED: transcription repressor MYB6-like
snpEff Effect synonymous_variant
Impact LOW
Codon c.27G>A
Amino Acid p.Pro9Pro
PCR Forward primer TGGTGGTGATCTGAGCCATA
Reverse primer TTCCACCAACTTTGCAACAA
Product size 275
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/ALT ALT/ALT REF/ALT REF/ALT REF/ALT ALT/ALT REF/ALT


| Top |