Cherry SNP DataBase

SNP information

Name Pav_sc0000598.1_86519Y
Chr PAV_r1.0chr4
Pos (Chr) 1971657
PAV_r1.0 Pav_sc0000598.1
Pos (PAV_r1.0) 86519
REF C
ALT T
SSR motif
Gene Name
Annotation
snpEff Effect intergenic_region
Impact MODIFIER
Codon n.86519C>T
Amino Acid
PCR Forward primer TACTCCAATTTGTTCCCCCA
Reverse primer TTAGTAAACTTTGGCATGCGG
Product size 200
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/ALT REF/REF REF/ALT REF/ALT REF/ALT REF/REF REF/ALT


| Top |