Cherry SNP DataBase

SNP information

Name Pav_sc0000600.1_77599Y
Chr PAV_r1.0chr4
Pos (Chr) 6217567
PAV_r1.0 Pav_sc0000600.1
Pos (PAV_r1.0) 77599
REF C
ALT T
SSR motif
Gene Name Pav_sc0000600.1_g130.1.mk
Annotation PREDICTED: cellulose synthase-like protein D3
snpEff Effect missense_variant
Impact MODERATE
Codon c.1474G>A
Amino Acid p.Ala492Thr
PCR Forward primer ACCTTGGAATTCTGCCACTC
Reverse primer TGTTGCTGCAGTGGTTTCTC
Product size 210
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/ALT REF/REF REF/REF REF/ALT REF/REF ALT/ALT REF/REF


| Top |