Cherry SNP DataBase

SNP information

Name Pav_sc0000615.1_45025M
Chr PAV_r1.0chr3
Pos (Chr) 16809072
PAV_r1.0 Pav_sc0000615.1
Pos (PAV_r1.0) 45025
REF C
ALT A
SSR motif
Gene Name
Annotation
snpEff Effect intergenic_region
Impact MODIFIER
Codon n.45025C>A
Amino Acid
PCR Forward primer GGAATTGTGGAAAGAAGGCA
Reverse primer AAGCAGGTTCTTTGGAGGGT
Product size 206
Enzymes for CAPS MboI
Exp. fragment size (REF) 124,82
Exp. fragment size (ALT) 206
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
ALT/ALT REF/REF REF/REF REF/ALT REF/ALT REF/ALT REF/REF


| Top |