Cherry SNP DataBase

SNP information

Name Pav_sc0000622.1_290505K
Chr PAV_r1.0chr4
Pos (Chr) 16254290
PAV_r1.0 Pav_sc0000622.1
Pos (PAV_r1.0) 290505
REF T
ALT G
SSR motif
Gene Name Pav_sc0000622.1_g550.1.mk
Annotation PREDICTED: kinesin-like protein KIN12A
snpEff Effect 3_prime_UTR_variant
Impact MODIFIER
Codon c.*71T>G
Amino Acid
PCR Forward primer TATATCGCGAGGATTCTGCC
Reverse primer TCCAATGATTCATACAAAAGCA
Product size 292
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/ALT REF/ALT ALT/ALT REF/ALT REF/REF REF/ALT REF/ALT


| Top |