Cherry SNP DataBase

SNP information

Name Pav_sc0000622.1_346591S
Chr PAV_r1.0chr4
Pos (Chr) 16198204
PAV_r1.0 Pav_sc0000622.1
Pos (PAV_r1.0) 346591
REF G
ALT C
SSR motif
Gene Name Pav_sc0000622.1_g670.1.mk
Annotation PREDICTED: probable leucine-rich repeat receptor-like protein kinase At5g49770
snpEff Effect splice_region_variant&intron_variant
Impact LOW
Codon c.711-6G>C
Amino Acid
PCR Forward primer ATCTGACTGGCAGCATTCCT
Reverse primer GGACAAGTGCCTGAAACCAT
Product size 345
Enzymes for CAPS AfaI
Exp. fragment size (REF) 137,20,37,151
Exp. fragment size (ALT) 137,57,151
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/ALT REF/REF REF/REF REF/ALT ALT/ALT REF/ALT REF/REF


| Top |