Cherry SNP DataBase

SNP information

Name Pav_sc0000622.1_346696R
Chr PAV_r1.0chr4
Pos (Chr) 16198099
PAV_r1.0 Pav_sc0000622.1
Pos (PAV_r1.0) 346696
REF A
ALT G
SSR motif
Gene Name Pav_sc0000622.1_g670.1.mk
Annotation PREDICTED: probable leucine-rich repeat receptor-like protein kinase At5g49770
snpEff Effect intron_variant
Impact MODIFIER
Codon c.782+28A>G
Amino Acid
PCR Forward primer ATCTGACTGGCAGCATTCCT
Reverse primer GGACAAGTGCCTGAAACCAT
Product size 345
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/ALT REF/REF REF/REF REF/ALT ALT/ALT REF/ALT REF/REF


| Top |