Cherry SNP DataBase

SNP information

Name Pav_sc0000633.1_62368M
Chr PAV_r1.0chr0
Pos (Chr) 17566741
PAV_r1.0 Pav_sc0000633.1
Pos (PAV_r1.0) 62368
REF C
ALT A
SSR motif
Gene Name Pav_sc0000633.1_g030.1.br
Annotation
snpEff Effect intron_variant
Impact MODIFIER
Codon c.255+107C>A
Amino Acid
PCR Forward primer GACGGTCTCTGGGATTTTGA
Reverse primer CTGGGGGAGGTCAGTGTAAA
Product size 270
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF ALT/ALT REF/ALT REF/REF REF/ALT REF/ALT REF/ALT


| Top |