Cherry SNP DataBase

SNP information

Name Pav_sc0000636.1_265556M
Chr PAV_r1.0chr2
Pos (Chr) 25194974
PAV_r1.0 Pav_sc0000636.1
Pos (PAV_r1.0) 265556
REF A
ALT C
SSR motif
Gene Name Pav_sc0000636.1_g640.1.mk
Annotation PREDICTED: dual specificity tyrosine-phosphorylation-regulated kinase 1A isoform X1
snpEff Effect intron_variant
Impact MODIFIER
Codon c.-2123+894A>C
Amino Acid
PCR Forward primer TCTGTCTCTCCTTTTCCCCA
Reverse primer AAATGAAGGTCCGTGTCTCG
Product size 239
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/ALT REF/REF REF/REF REF/REF REF/REF REF/REF


| Top |