Cherry SNP DataBase

SNP information

Name Pav_sc0000637.1_19730R
Chr PAV_r1.0chr4
Pos (Chr) 6390315
PAV_r1.0 Pav_sc0000637.1
Pos (PAV_r1.0) 19730
REF G
ALT A
SSR motif
Gene Name Pav_sc0000637.1_g010.1.mk
Annotation PREDICTED: cyclic nucleotide-gated ion channel 1-like
snpEff Effect intron_variant
Impact MODIFIER
Codon c.329-6226G>A
Amino Acid
PCR Forward primer CCCTCGTTTGTTTCCCACTA
Reverse primer TTCCAGTCTTTGTGGCAGTG
Product size 345
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/ALT REF/REF REF/ALT REF/ALT ALT/ALT REF/ALT REF/ALT


| Top |