Cherry SNP DataBase

SNP information

Name Pav_sc0000637.1_40842M
Chr PAV_r1.0chr4
Pos (Chr) 6369203
PAV_r1.0 Pav_sc0000637.1
Pos (PAV_r1.0) 40842
REF A
ALT C
SSR motif
Gene Name Pav_sc0000637.1_g030.1.mk
Annotation PREDICTED: LOW QUALITY PROTEIN: coatomer subunit alpha-1-like
snpEff Effect intron_variant
Impact MODIFIER
Codon c.4477+157T>G
Amino Acid
PCR Forward primer TGGCATCATGAACATTGGAT
Reverse primer GCAGACGATCGACAAGTGAA
Product size 317
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/ALT REF/REF REF/REF REF/ALT REF/REF REF/REF REF/REF


| Top |