Cherry SNP DataBase

SNP information

Name Pav_sc0000638.1_153657M
Chr PAV_r1.0chr6
Pos (Chr) 153657
PAV_r1.0 Pav_sc0000638.1
Pos (PAV_r1.0) 153657
REF A
ALT C
SSR motif
Gene Name Pav_sc0000638.1_g320.1.mk
Annotation PREDICTED: ABC transporter G family member 31
snpEff Effect intron_variant
Impact MODIFIER
Codon c.797-857A>C
Amino Acid
PCR Forward primer TTAGGCTTTCGTCTACCCCC
Reverse primer TGACAAAGCTGCAGGATGAC
Product size 303
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/REF REF/REF REF/ALT REF/ALT REF/REF REF/REF


| Top |