Cherry SNP DataBase

SNP information

Name Pav_sc0000648.1_26778Y
Chr PAV_r1.0chr8
Pos (Chr) 16069914
PAV_r1.0 Pav_sc0000648.1
Pos (PAV_r1.0) 26778
REF T
ALT C
SSR motif
Gene Name
Annotation
snpEff Effect intergenic_region
Impact MODIFIER
Codon n.26778T>C
Amino Acid
PCR Forward primer CGGATAGGGACTAACACCCA
Reverse primer CTGTGAGCTCCACAAACCAA
Product size 308
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/ALT REF/ALT REF/ALT REF/ALT REF/REF ALT/ALT REF/ALT


| Top |