Cherry SNP DataBase

SNP information

Name Pav_sc0000661.1_69113Y
Chr PAV_r1.0chr3
Pos (Chr) 18259787
PAV_r1.0 Pav_sc0000661.1
Pos (PAV_r1.0) 69113
REF T
ALT C
SSR motif
Gene Name Pav_sc0000661.1_g110.1.mk
Annotation PREDICTED: kanadaptin
snpEff Effect missense_variant
Impact MODERATE
Codon c.1142T>C
Amino Acid p.Val381Ala
PCR Forward primer AATGCTCGGACCATGTGAAT
Reverse primer AAAGCAATTCTTTCTTTTCTTCCA
Product size 343
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/ALT REF/ALT REF/ALT REF/ALT REF/ALT REF/ALT


| Top |