Cherry SNP DataBase

SNP information

Name Pav_sc0000661.1_88305Y
Chr PAV_r1.0chr3
Pos (Chr) 18278979
PAV_r1.0 Pav_sc0000661.1
Pos (PAV_r1.0) 88305
REF T
ALT C
SSR motif
Gene Name Pav_sc0000661.1_g150.1.mk
Annotation PREDICTED: F-box/kelch-repeat protein At5g15710
snpEff Effect missense_variant
Impact MODERATE
Codon c.91T>C
Amino Acid p.Cys31Arg
PCR Forward primer GGTGCTGGGAAATCTTCTGA
Reverse primer ATGGCGGAACCCTAGCTAAT
Product size 331
Enzymes for CAPS HhaI
Exp. fragment size (REF) 331
Exp. fragment size (ALT) 86,245
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/ALT REF/ALT REF/ALT REF/REF REF/ALT REF/ALT


| Top |