Cherry SNP DataBase

SNP information

Name Pav_sc0000666.1_15595K
Chr PAV_r1.0chr6
Pos (Chr) 15461474
PAV_r1.0 Pav_sc0000666.1
Pos (PAV_r1.0) 15595
REF T
ALT G
SSR motif
Gene Name Pav_sc0000666.1_g040.1.mk
Annotation PREDICTED: peptidyl-prolyl cis-trans isomerase-like 2
snpEff Effect intron_variant
Impact MODIFIER
Codon c.804+67T>G
Amino Acid
PCR Forward primer TCAGTGCATGGAAGAAGTGC
Reverse primer GTGAAGGATCTCGAAGCAGC
Product size 316
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
ALT/ALT REF/ALT REF/ALT REF/ALT REF/ALT ALT/ALT REF/ALT


| Top |