Cherry SNP DataBase

SNP information

Name Pav_sc0000689.1_235504K
Chr PAV_r1.0chr3
Pos (Chr) 2472182
PAV_r1.0 Pav_sc0000689.1
Pos (PAV_r1.0) 235504
REF G
ALT T
SSR motif
Gene Name Pav_sc0000689.1_g360.1.mk
Annotation
snpEff Effect missense_variant
Impact MODERATE
Codon c.104G>T
Amino Acid p.Gly35Val
PCR Forward primer AGGCAATGTTGCTCCCAATA
Reverse primer ACACCTGAATTTCCAGCCAC
Product size 349
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
ALT/ALT REF/REF REF/REF REF/ALT REF/ALT ALT/ALT REF/REF


| Top |