Cherry SNP DataBase

SNP information

Name Pav_sc0000700.1_831802R
Chr PAV_r1.0chr6
Pos (Chr) 23067436
PAV_r1.0 Pav_sc0000700.1
Pos (PAV_r1.0) 831802
REF A
ALT G
SSR motif
Gene Name Pav_sc0000700.1_g1570.1.mk
Annotation PREDICTED: uncharacterized protein LOC103318570
snpEff Effect intron_variant
Impact MODIFIER
Codon c.793+41A>G
Amino Acid
PCR Forward primer AATCGGATTGCTGAAACTGC
Reverse primer CAATCGTTCACCTGCGTAGA
Product size 318
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/ALT REF/ALT REF/ALT REF/ALT REF/REF REF/ALT


| Top |