Cherry SNP DataBase

SNP information

Name Pav_sc0000700.1_905146R
Chr PAV_r1.0chr6
Pos (Chr) 23140780
PAV_r1.0 Pav_sc0000700.1
Pos (PAV_r1.0) 905146
REF G
ALT A
SSR motif
Gene Name Pav_sc0000700.1_g1750.1.mk
Annotation PREDICTED: multisubstrate pseudouridine synthase 7 isoform X1
snpEff Effect missense_variant
Impact MODERATE
Codon c.1711G>A
Amino Acid p.Val571Ile
PCR Forward primer AACAATGGCCATCAGAGAGC
Reverse primer ATTAGTCCCTCCCCGGTATG
Product size 297
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
ALT/ALT REF/ALT REF/ALT REF/ALT REF/ALT REF/ALT REF/REF


| Top |