Cherry SNP DataBase

SNP information

Name Pav_sc0000702.1_194420M
Chr PAV_r1.0chr2
Pos (Chr) 8072979
PAV_r1.0 Pav_sc0000702.1
Pos (PAV_r1.0) 194420
REF C
ALT A
SSR motif
Gene Name Pav_sc0000702.1_g320.1.mk
Annotation hypothetical protein VITISV_020655
snpEff Effect intron_variant
Impact MODIFIER
Codon c.1021-971G>T
Amino Acid
PCR Forward primer CAGAAGCCTCACCTTAACCG
Reverse primer GCTGAAGAATCTCACGCCAT
Product size 276
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
-/- REF/REF REF/REF REF/REF REF/ALT REF/REF REF/REF


| Top |