Cherry SNP DataBase

SNP information

Name Pav_sc0000702.1_335988S
Chr PAV_r1.0chr2
Pos (Chr) 8214547
PAV_r1.0 Pav_sc0000702.1
Pos (PAV_r1.0) 335988
REF C
ALT G
SSR motif
Gene Name Pav_sc0000702.1_g550.1.mk
Annotation PREDICTED: putative acyl-activating enzyme 19
snpEff Effect missense_variant
Impact MODERATE
Codon c.3235G>C
Amino Acid p.Glu1079Gln
PCR Forward primer TGAAAATCACATGCCAAACAA
Reverse primer CACAGCACCACTTTCCTCAA
Product size 231
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/REF REF/REF REF/REF REF/ALT REF/REF REF/REF


| Top |