Cherry SNP DataBase

SNP information

Name Pav_sc0000704.1_366769M
Chr PAV_r1.0chr7
Pos (Chr) 18276220
PAV_r1.0 Pav_sc0000704.1
Pos (PAV_r1.0) 366769
REF A
ALT C
SSR motif
Gene Name
Annotation
snpEff Effect intergenic_region
Impact MODIFIER
Codon n.366769A>C
Amino Acid
PCR Forward primer GATTCGATTTTCAAGCTGCG
Reverse primer GTACAAACTCCCCCATCCCT
Product size 345
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/ALT REF/REF -/- REF/REF REF/REF REF/REF


| Top |