Cherry SNP DataBase

SNP information

Name Pav_sc0000707.1_38944W
Chr PAV_r1.0chr6
Pos (Chr) 14440514
PAV_r1.0 Pav_sc0000707.1
Pos (PAV_r1.0) 38944
REF A
ALT T
SSR motif
Gene Name
Annotation
snpEff Effect
Impact
Codon
Amino Acid
PCR Forward primer TCACCATCAATTCCAAATGC
Reverse primer TGCATCCAATTTCGTTTGAA
Product size 337
Enzymes for CAPS DraI
Exp. fragment size (REF) 84,253
Exp. fragment size (ALT) 85,252
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/ALT REF/ALT REF/REF REF/ALT REF/ALT REF/ALT REF/REF


| Top |