Cherry SNP DataBase

SNP information

Name Pav_sc0000711.1_29453Y
Chr PAV_r1.0chr6
Pos (Chr) 16469419
PAV_r1.0 Pav_sc0000711.1
Pos (PAV_r1.0) 29453
REF C
ALT T
SSR motif
Gene Name Pav_sc0000711.1_g030.1.mk
Annotation PREDICTED: synaptotagmin-3-like
snpEff Effect missense_variant
Impact MODERATE
Codon c.407C>T
Amino Acid p.Ala136Val
PCR Forward primer ATGAGCTGGTGTTTGAGCCT
Reverse primer TTATTCGACGAGGGTGTGAA
Product size 319
Enzymes for CAPS HhaI
Exp. fragment size (REF) 89,37,193
Exp. fragment size (ALT) 126,193
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
ALT/ALT REF/ALT REF/ALT REF/ALT REF/ALT ALT/ALT REF/ALT


| Top |