Cherry SNP DataBase

SNP information

Name Pav_sc0000716.1_346174K
Chr PAV_r1.0chr3
Pos (Chr) 5305423
PAV_r1.0 Pav_sc0000716.1
Pos (PAV_r1.0) 346174
REF G
ALT T
SSR motif
Gene Name Pav_sc0000716.1_g520.1.mk
Annotation PREDICTED: pentatricopeptide repeat-containing protein At1g15510, chloroplastic
snpEff Effect missense_variant
Impact MODERATE
Codon c.20C>A
Amino Acid p.Ser7Tyr
PCR Forward primer CACACAGCCTAACCAAAGCA
Reverse primer ATCCTCAATTCCCCAAGACC
Product size 261
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/ALT REF/REF -/- REF/REF REF/REF REF/REF


| Top |