Cherry SNP DataBase

SNP information

Name Pav_sc0000729.1_31443M
Chr PAV_r1.0chr4
Pos (Chr) 6673103
PAV_r1.0 Pav_sc0000729.1
Pos (PAV_r1.0) 31443
REF C
ALT A
SSR motif
Gene Name Pav_sc0000729.1_g070.1.br
Annotation PREDICTED: tetrahydrocannabinolic acid synthase-like
snpEff Effect missense_variant
Impact MODERATE
Codon c.1382C>A
Amino Acid p.Ser461Tyr
PCR Forward primer GACACCTTTTGGCGGAATAA
Reverse primer GTAGCTCAAACCCCAAATGC
Product size 280
Enzymes for CAPS AfaI
Exp. fragment size (REF) 280
Exp. fragment size (ALT) 179,101
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/ALT REF/REF REF/REF REF/ALT REF/REF REF/REF REF/REF


| Top |