Cherry SNP DataBase

SNP information

Name Pav_sc0000744.1_209790R
Chr PAV_r1.0chr6
Pos (Chr) 24256725
PAV_r1.0 Pav_sc0000744.1
Pos (PAV_r1.0) 209790
REF G
ALT A
SSR motif
Gene Name
Annotation
snpEff Effect intergenic_region
Impact MODIFIER
Codon n.209790G>A
Amino Acid
PCR Forward primer CCGATGATGATCAGGGTCTT
Reverse primer TGCTACCTCGCCCTAAAGAA
Product size 334
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
ALT/ALT REF/ALT REF/ALT REF/ALT REF/ALT ALT/ALT REF/ALT


| Top |