Cherry SNP DataBase

SNP information

Name Pav_sc0000744.1_29836S
Chr PAV_r1.0chr6
Pos (Chr) 24076771
PAV_r1.0 Pav_sc0000744.1
Pos (PAV_r1.0) 29836
REF G
ALT C
SSR motif
Gene Name Pav_sc0000744.1_g080.1.mk
Annotation PREDICTED: ferrochelatase-2, chloroplastic
snpEff Effect missense_variant
Impact MODERATE
Codon c.29C>G
Amino Acid p.Pro10Arg
PCR Forward primer GTCCTTGGAGAAGAGCAACG
Reverse primer TCAACACCCATAGCCAAACA
Product size 304
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/REF REF/REF -/- REF/REF REF/ALT REF/REF


| Top |