Cherry SNP DataBase

SNP information

Name Pav_sc0000754.1_61477Y
Chr PAV_r1.0chr5
Pos (Chr) 9281932
PAV_r1.0 Pav_sc0000754.1
Pos (PAV_r1.0) 61477
REF T
ALT C
SSR motif
Gene Name Pav_sc0000754.1_g100.1.mk
Annotation PREDICTED: putative glucose-6-phosphate 1-epimerase
snpEff Effect intron_variant
Impact MODIFIER
Codon c.187-97T>C
Amino Acid
PCR Forward primer CTTTCCTGGAGGACTGAACG
Reverse primer TTGGTGGCTTAAAGATTGCC
Product size 290
Enzymes for CAPS MboI
Exp. fragment size (REF) 172,63,55
Exp. fragment size (ALT) 235,55
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
ALT/ALT ALT/ALT REF/ALT REF/ALT REF/REF REF/REF REF/ALT


| Top |