Cherry SNP DataBase

SNP information

Name Pav_sc0000754.1_61567Y
Chr PAV_r1.0chr5
Pos (Chr) 9282022
PAV_r1.0 Pav_sc0000754.1
Pos (PAV_r1.0) 61567
REF T
ALT C
SSR motif
Gene Name Pav_sc0000754.1_g100.1.mk
Annotation PREDICTED: putative glucose-6-phosphate 1-epimerase
snpEff Effect splice_region_variant&intron_variant
Impact LOW
Codon c.187-7T>C
Amino Acid
PCR Forward primer AAATCATGAACGAATGGGAAA
Reverse primer CCAATGATCCATTTCCAACC
Product size 266
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
ALT/ALT ALT/ALT REF/ALT REF/ALT REF/REF REF/REF REF/ALT


| Top |