Cherry SNP DataBase

SNP information

Name Pav_sc0000759.1_8531M
Chr PAV_r1.0chr3
Pos (Chr) 3562898
PAV_r1.0 Pav_sc0000759.1
Pos (PAV_r1.0) 8531
REF C
ALT A
SSR motif
Gene Name Pav_sc0000759.1_g040.1.mk
Annotation
snpEff Effect intron_variant
Impact MODIFIER
Codon c.1000+42G>T
Amino Acid
PCR Forward primer ATGTTTGCGCACTTCATCAG
Reverse primer CCGTTCCCCTTATTCCTTTT
Product size 286
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
ALT/ALT ALT/ALT REF/REF REF/ALT REF/ALT ALT/ALT REF/ALT


| Top |